Potassium Uptake,
Physiological and Molecular Responses in Different Winter Wheat Cultivars under
Deficit Irrigation and Potassium Levels
Xinyang Bai1,2†,
Yongsheng Zhang3†, Zijian
Chen1,2, Fangfang Li1,2, Shuang Zhang1,2 and
Kai Xiao1,2*
1College of Agronomy, Hebei Agricultural University, Baoding, Hebei
071001, P. R. China
2Key Laboratory of Crop Growth
Regulation of Hebei Province, P. R. China
3College of Life Sciences, Hebei
Agricultural University, Baoding, Hebei 071001, P. R. China
*For correspondence:
xiaokai@hebau.edu.cn
†Contributed equally to this work
and are co-first authors
Received 05 March 2020;
Accepted 28 November 2020; Published 16 April 2021
Abstract
Improving potassium (K) use efficiency (KUE) is
beneficial for the sustainable production of cereal crops. In this study, the
effects of K input level on its uptake and agronomic trait of the winter wheat under
deficit irrigation were investigated in K deprivation responses, using two
cultivars contrasting (low-K tolerant cultivar Kenong 9204 and K deprivation
sensitive one Jimai 120). Under sufficient-K
treatment (K180, SK), the two cultivars showed similar K contents, and K
accumulation, biomass, photosynthetic parameters in upper expanded leaves, including
yield components. Under deficient-K (K60, DK) condition, both cultivars showed
varied behaviors of the K-associated traits, physiological parameters, growth
and agronomic traits; however, better response was observed in Kenong 9204 than
Jimai 120. These results suggested the essential roles
of low-K tolerant cultivars under the K-saving management together with deficit
irrigation. Two genes of the potassium transporter (HAK) family, TaHAK3 and TaHAK5, showed expression of significantly upregulated upon K
deprivation, with much more transcripts shown in the K-deprived Kenong 9204
plants than Jimai 120 ones. Transgene analysis on the
HAK genes validated their positive roles in modulating the K accumulation and
biomass production of plants under low-K condition. These results indicated
that distinct HAK family genes are transcriptionally regulated underlying K
deprivation signaling and contribute to plant K uptake and biomass production
under low-K conditions. This study suggested the drastically genetic variation
on K uptake and biomass production across winter wheat cultivars treated by K-
and water-saving conditions, associated with transcription efficiency of the
distinct HAK genes which modulate K uptake, growth and development of plants. ©
2021 Friends Science Publishers
Keywords: Wheat; K input level; Plant biomass; K
acquisition; Agronomic traits; Gene expression
Introduction
Potassium (K) is one of the critical inorganic nutrients
for plant growth and development, playing essential roles in the regulation of
various physiological processes including photosynthesis (Lupton 2008), water
uptake (Zamir et al. 2013), inorganic
nutrient accumulation (Wu et al.
2005), biomass production (Shen et al.
2014), and yield formation capacity of the cereal crops (Wani
et al. 2014). However, K use efficiencies
(KUE) of crop cultivars for K fertilizer applied are frequently low and urgent
to be further elevated for the sustainable development of regional agriculture
(Rengel and Damon 2008). Developing high KUE
cultivars combined with K-saving cultivation in wheat has been one of the
effective strategies in promoting the crop productivity around the world.
As one essential cropping
pattern, the winter wheat/summer maize planting system contributes greatly to
the food security in North China (Hu et
al. 2014). Of which, the growing cycle for winter wheat lasts approximately
eight months in this ecological region (i.e.,
from early of October to mid-June next year). Due to less precipitation during
the growth duration, the winter wheat plants are supplied by much more of
natural water resources provided by irrigation at several growth stages, such
as prior to seeds-sown, jointing, flowering, and mid-filling. However, this
kind of affluent irrigation management has resulted in drastic consumption of
the underground water resource, leading to the limitation in regional sustainable
crop production and causing the environmental issues (Ma et al. 2015; Wang et al.
2016). Establishment of suitable water-saving cultivation system is valuable
for the winter wheat production in North China and other zones with similar
ecology.
A set of studies has indicated
the close associations between the K availability in growth media and the plant
growth, development, and the yield formation capacity of cereal crops (Lupton
2008; Wani et
al. 2014). Thus far, the properties of K uptake and internal K
translocation across plant tissues have been elucidated in T. aestivum species under various
cultivation treatments (Wu et al.
2005; Erdei et
al. 2006). A drastic variation on K acquisition and its deprivation
response has been recorded among the wheat cultivars. Based on behaviors of
plant K acquisition, biomass, and grain yields under K deprivation conditions,
the wheat cultivars are categorized into different KUE including high, middle,
and low KUE ones (Rengel and Damon 2008). The plants
of high KUE cultivars generally possess enhanced capacities of K uptake, dry
matter production, and yield formation under K-limited conditions with respect
to the low KUE ones, due to the improvement on root development, photosynthetic
function, and the related biochemical processes (Song et al. 2017). Moreover, distinct molecular processes associated
with K uptake and internal K remobilization across plant tissues in response to
external K levels have also been investigated (Erdei et al. 2006). Further elucidation of the
mechanisms impacting on KUE under K deprivation can promote high KUE cultivar
breeding of winter wheat, which benefit the crop cultivation under the K-saving
and limited-water management.
Although the investigations
related to K uptake and internal remobilization of plants have been conducted
in winter wheat (Wu et al. 2005; Erdei et al.
2006), detailed processes associated with K accumulation, agronomic trait, and
the corresponding molecular biology under water- and K-saving cultivation
system are still needed to be further characterized. In this study, two winter
wheat cultivars including Kenong 9204, a high KUE cultivar and Jimai 120, K deprivation sensitive, were selected to
characterize the K uptake traits, physiological and agronomic traits, and the
related molecular processes under different K levels combined by deficit
irrigation. These results provide insights into the genetic variation on
K-associated and agronomic traits of plants in wheat cultivars, which benefit
elite cultivar breeding and resource-saving cultivation of winter wheat aimed
at sustainable crop production.
Materials and Methods
Experimental design
The experiments were conducted at Liujiazhuang
village, Gaocheng City, China, during the 2016–2017
and 2017–2018 growth seasons. The climate in the experimental region is
specified by the temperate continental monsoon with concentrated precipitation
at the summer season. Meteorological factors at spring growth stage during the
two growth seasons are shown in Table 1. The surface soil layer (0–25 cm) in
experimental plots was loamy and contained following nutrients: organic mater
18.25 g/kg, available N 82.46 mg/kg, available P 16.57 (Olsen-P) mg/kg, and
exchangeable K 120.40 mg/kg. The soil texture was typified by an alluvial soil
type generally shown in the North China plain, with pH 7.82. Plots were
arranged by a randomized split design with triplicates, with K input level as
main plot whereas cultivar as sub-plot. The main plot contained two K levels:
sufficient-K 180 kg/ha KO2 (K180, SK) and deficient-K 60 kg/ha KO2
(K60, DK). The sub-plot contained two cultivars: Kenong 9204, low-K tolerant
cultivar and Jimai 120, K deprivation sensitive.
Seeds of the tested cultivars were sown in plots (35 m2 with 7 m in
length and 5 m in width each) on October 8 and 7 during the 2016–2017 and 2017–2018
seasons, respectively. For the K input, SK was established by using basal
complex fertilizer (N: P2O5: K2O for 15: 15:
15) with amount 600 kg/ha together with basal K2O of 90 kg/ha (KCl as K source) and top dressed 135 N kg/ha (urea as N
source) at jointing stage. The DK level was set up using the complex fertilizer
and amount was top dressed for N nutrition mentioned above. During the two
seasons, the seeds were sown in rows with 15 cm distance to establish an about 3,750
thousand-seedling population per hectare. Before seeds-sown, the straws of
summer maize were mechanically broken into pieces after harvest and mixed well
with the basal fertilizers. To manage deficit irrigation, two irrigations, one
prior to seeds-sown and another at jointing stage with water amount of 67.5 mm
each controlled by a water calculator, were conducted for all of treatments.
Other cultivation techniques were like the conventional ones used by local
farmers.
Measurements of yields and yield components
At maturity, the spikes in two square meters were
counted in each plot to calculate the population spike numbers. The spike
grains were threshed from each plot using a mini harvest machine at maturity
(June 13 and 11 at 2017 and 2018, respectively) to calculate the yields after
seed air drying. The grain weights were obtained by weighing one thousand
air-dried grains. The spike kernel numbers were obtained by counting the seeds
in thirty representative spikes.
Plant biomass and the K-associated traits
At stages of jointing, flowering, mid-filling, and
maturity, twenty representative plants in each plot were sampled to measure
biomass, K concentrations, and the K accumulative amounts. Among these, plant
biomass was obtained based on the oven-dried samples; K concentrations in the
samples were measured using the methods (Guo et al. 2011). The K
accumulative amounts in plants were calculated by multiplying the biomass and
the K concentrations.
Measurements of photosynthetic traits
Table 1:
Meteorological factors at spring growth stage during the 2016–2017 and
2017–2018 seasons
Year |
10 d |
Average
temperature (ˇăC) |
Precipitation
(mm) |
Total
sunshine (hour) |
Solar
radiation (W/m2) |
||||||||
April |
May |
June |
April |
May |
June |
April |
May |
June |
April |
May |
June |
||
2017 |
First |
10.23 |
21.23 |
24.22 |
1.22 |
1.56 |
13.22 |
78.23 |
86.83 |
84.63 |
202.23 |
233.02 |
250.38 |
Second |
13.23 |
24.80 |
27.23 |
0.32 |
10.22 |
5.12 |
89.12 |
113.04 |
84.90 |
253.23 |
283.34 |
252.06 |
|
Third |
16.43 |
24.48 |
27.01 |
6.23 |
14.65 |
36.04 |
102.32 |
110.71 |
80.42 |
231.21 |
266.28 |
224.18 |
|
2018 |
First |
8.92 |
20.30 |
26.52 |
2.23 |
8.60 |
23.84 |
80.12 |
87.88 |
86.13 |
213.08 |
242.03 |
232.33 |
Second |
14.23 |
22.02 |
26.58 |
1.03 |
22.63 |
25.12 |
68.23 |
45.73 |
82.83 |
239.23 |
250.16 |
239.41 |
|
Third |
17.03 |
23.61 |
30.11 |
10.22 |
40.56 |
2.23 |
90.48 |
111.42 |
85.82 |
261.22 |
274.42 |
231.00 |
Table 2: Information of the HAK family genes in T. aestivum
and primers used for qRT-PCR analysis
Purpose |
Accession
number |
Forward
primer (5´-) |
Reverse
primer (5´-) |
TaHAK1 expression |
KU212875 |
CCTTACTTACCCAAATTGCAAA |
ACTTCCCAGAGAAGCCAACCC |
TaHAK2 expression |
JF495466 |
CTCGGGGAGGATGAGCTTC |
CCTTCTTCAAGATGGAGGA |
TaHAK3 expression |
DQ009003 |
GCAAGAGCTAAACACGATA |
TCCTGGCAGATGATCTCTGGG |
TaHAK4 expression |
DQ015706 |
GTTTTGCAGCGCATATGGCAA |
TTAAGCCTTCCATAGAGCATG |
TaHAK5 expression |
KR422354 |
CCGAGAGGAGATCGCTCTC |
CCAGGACAAGAACCACCTTC |
TaHAK6 expression |
KU212870 |
GGCATTGTGTGAACTGTGCTTG |
ATGCCTCGCCACCATGCATG |
TaHAK7 expression |
KU212871 |
GCCGTGGTGTGCATCACGGA |
AATGGTATCGATCATGCATGG |
TaHAK8 expression |
KU212872 |
GCCGTGGTGTGCATCACGGA |
AATGGTATCGATCATGCATGG |
TaHAK9 expression |
KU212873 |
ACACAAAACCTTACTTACCCAA |
TGTACCCGGTGCTGAACCCC |
TaHAK10 expression |
KU212874 |
GGCGGAAGCTGCTCATGTCG |
GTGGATTACCTGATAACCTCG |
TaHAK11 expression |
KU184266 |
GCTATTGCGACCACTATAACG |
TTGAGCCTGCCGTAGAACATG |
TaHAK12 expression |
KF646596 |
AAAGGAGAAGGCTCAGAAACGA |
GGCAGATGATCTCTGGGTGCA |
TaHAK13 expression |
KF646595 |
GGCATTCTCACCGCTCGGA |
TGGCAGATGATCTCTGGGTG |
Tatubulin expression |
U76558 |
CATGCTATCCCTCGTCTCGACCT |
CGCACTTCATGATGGAGTTGTAT |
TaHAK3 overexpression cassette |
DQ009003 |
TTTCCATGGGCCGGGTGAAAAGATT |
TTTGGTAACCAATCTTTTCACCCGGCCCAT |
TaHAK5 overexpression cassette |
KR422354 |
TTTCCATGGCTGTCCGGCTGCAT |
TTTGGTAACCATTATTCAGGACCAATC |
Table 3: Grain yields and the yield components of the
tested cultivars under various K input treatments
Growing season |
K treatment |
Cultivar |
Spike number (104 ha-1) |
Kernel numbers |
Grain weight (g) |
Yield (kg ha-1) |
2016-2017 |
SK |
Kenong 9204 |
703.45 a |
32.22 a |
40.23 a |
7780.08 a |
Shimai 120 |
715.36 a |
32.17 a |
40.02 a |
7816.39 a |
||
DK |
Kenong 9204 |
655.50 b |
31.06 ab |
39.13 b |
6789.66 b |
|
Shimai 120 |
632.14 c |
30.23 b |
38.28 b |
6234.82 c |
||
2017-2018 |
SK |
Kenong 9204 |
690.32 a |
32.83 a |
42.64 a |
8218.05 a |
Shimai 120 |
700.05 a |
32.66 a |
42.38 a |
8230.27 a |
||
DK |
Kenong 9204 |
659.42 b |
31.55 ab |
41.48 ab |
7245.26 b |
|
Shimai 120 |
636.23 c |
30.00 b |
40.60 b |
6485.49 c |
SK, sufficient K (K180). DK, deficient K (K60). Data are
shown by averages from triplicates and different lowercase letters indicate to
be statistical significance between two tested cultivars across the K input
treatments at each growth season
During the two growth
seasons, photosynthetic parameters in each cultivar under different K input
treatments were assessed at various growth stages (i.e., jointing, flowering, mid-filling, and maturity) using
representative upper leaves as samples. The parameters assessed included
chlorophyll contents (Chl), photosynthetic rate (Pn), stomatal conductance (gs),
intercellular CO2 concentrations (Ci), photosystem II photochemical
efficiency (¦·PSII), and NPQ. Among them, the Chl was
recorded by SPAD-502 analyser; Pn,
gs, and Ci were measured using the photosynthesis
assay system (Li-COR6200); PSII and NPQ in samples were determined as described
previously (Guo et al. 2013).
Assay of expression patterns of the potassium
transporter (HAK) family genes
At stages of flowering during the two seasons,
representative flag leaves of the tested cultivars were sampled under K input
treatments and subjected to expression evaluation of the potassium transporter
(HAK) family genes. The genes of the HAK family examined included TaHAK1 to TaHAK13. The information of the HAK family genes examined is shown
in Table 2. Transcripts of the genes were determined based on qRT-PCR using gene specific primers (Table 2) performed as
previously described (Guo et al. 2013). Tatubulin, a constitutive gene in
T. aestivum,
was used as the internal reference to normalize the target transcripts.
Transgene analysis on the differential HAK gene
TaHAK3 and TaHAK5, two differential genes shown in the K-deprived plants of the two tested cultivars, were
functionally characterized for the roles in mediating plant K uptake under DK
treatment. With this purpose, the open reading frames of TaHAK3 and TaHAK5 were
amplified based on RT-PCR in sense orientation. The products were then
separately integrated into the vector pCAMBIA3301 and genetically transformed
into T. aestivum
(cv. Kenong 9204) (Guo et al. 2013). Two T3 lines HAK3-1 and HAK3-3
with TaHAK3 overexpression and HAK5-2
and HAK5-3 with TaHAK5 overexpression
together with wild type (WT) were subjected to DK treatment by growing the
three-leaf seedlings in the modified MS solution containing low K (0.1 mM K2O). Four weeks after the
treatments, the K concentrations, biomass, K accumulative amounts, and
photosynthetic parameters in transgenic and WT plants were assessed.
Statistical analysis
Averages, standard errors, and significant test analysis
for plant biomass, K-associated traits, photosynthetic parameters, agronomic
traits, and the transcripts of the HAK family genes were calculated based on S.P.S.S.
16.0 statistical software supplemented in Excel of the Windows system.
Results
The yield and its components
Two cultivars (i.e.,
Kenong 9204 and Jimai 120) examined had similar phonological
dates at each growth stage under various K input treatments (data not shown).
Compared with under high K input treatment (SK), the yields and the yield
components of the two cultivars were lowered under deficient-K treatment (DK)
(Table 3). The Kenong 9204 showed comparable above agronomic traits with Jimai 120 under SK. However, under DK conditions, the
former exhibited higher yields and much more improved population spike amounts,
kernel numbers per spike, and grain weights than the latter (Table 3).
Fig. 1: Plant growth and K-associated traits at various growth
stages in tested cultivars under different K input treatments
A, plant
biomass; B, plant K concentrations; C, plant K accumulative amounts. SK,
sufficient-K. DK, deficient-K. Data shown are averages derived from triplicate
results together with standard errors. Symbol * indicates to be statistically
significant between the cultivars at each assay time under same treatment, according
to Student T-test at 0.05 level
Plant biomass and the K-associated traits
The K concentrations, plant biomass, and K accumulative
amounts in the tested cultivar plants were higher at various stages (i.e., jointing, flowering, mid-filling,
and maturity) under SK than DK (Fig. 1A–C). Likewise, compared with Jimai 120, Kenong 9204 was similar on the plant biomass and
K-associated traits at each growth stage under SK and significantly improved
these traits under DK (Fig. 1A–C).
Behaviors of the photosynthetic parameters
In consistent with the plant biomass upon different K
levels, the plants in tested cultivars displayed improved photosynthetic
parameters, including higher Chl, Pn,
gs, PSII,
and lower Ci and NPQ under SK than DK
(Fig. 2A–F). Additionally, these traits were much more improved in Kenong 9204
plants under DK than Jimai 120 ones (Fig. 2A–F).
These results suggested that the enhanced photosynthetic function shown under
DK was associated with the improved K uptake which further positively affected
the plant biomass production and the yield formation capacity.
Fig. 2: Photosynthetic parameters at various growth stages in
tested cultivars under different K input treatments
A, Chl; B, Pn; C, gs;
D, Ci; E, ¦·PSII; F,
NPQ. SK, sufficient-K. DK, deficient-K. Data shown are averages derived from
triplicate results together with standard errors. Symbol * indicates to be
statistically significant between the cultivars at each assay time under same
treatment, according to Student T-test at 0.05 level
Fig. 3: Expression patterns of the potassium transporter family
under different K input treatments
SK, sufficient-K. DK, deficient-K. Transcripts of the
target genes were normalized by internal standard Tatubulin, a constitutive gene in
T. aestivum.
Data sets shown are averages derived from triplicate results together
with standard errors. Symbol * indicates to be significantly different in
the tested cultivars under treatments relative to control according to Student
T-test at 0.05 level
Fig. 4: Growth and K-associated traits of lines overexpressing TaHAK3 and TaHAK5 under different K input treatments
A, plant
biomass; B, plant K concentrations; C, plant K accumulative amounts. SK,
sufficient-K. DK, deficient-K. HAK3-1 and HAK3-3, two lines with overexpression
of TaHAK3; HAK5-2 and HAK5-3, two
lines with overexpression of TaHAK5. Data
shown are averages derived from triplicate results together with standard
errors. Symbol * indicates to be significantly different between transgenic
lines and wild type according to Student T-test at 0.05 level
Expression patterns of the HAK family genes upon K
deprivation
A set of K transporter
(KT) family genes in T. aestivum species, including TaHAK1 to TaHAK10, were
subjected to expression evaluation to address the molecular processes
underlying plant K uptake under the SK and DK conditions. Among the genes
examined, TaHAK3 and TaHAK5 were upregulated in the
K-deprived cultivar plants, which was in contrast to the other HAK genes which
unaltered in expression patterns in the plants under both SK and DK conditions
(Fig. 3). Moreover, induced extent on these two HAK gene transcripts under DK
was intensified in the Kenong 9204 plants with respect to Jimai
120 ones (Fig. 3).
Growth and
K-associated traits of TaHAK3 and TaHAK3 transgenic lines under DK
conditions
Under the SK condition, the transgenic lines were
comparable on K concentrations, biomass and K accumulative amounts with the wild
type (Figs. 4A–4C). Under DK treatment, however, the lines were much more improved
on the plant biomass and the K-associated traits with respect to wild type
(Figs. 4A–4C).
Photosynthetic
parameters of TaHAK3 and TaHAK3 transgenic lines under DK
conditions
The transgenic lines with overexpression of TaHAK3 and TaHAK5 were subjected to assessment of the photosynthetic
parameters. Similar to the behaviors on plant biomass, the transgenic lines
(HAK3-1, HAK3-3, HAK5-2, and HAK5-3) showed comparable photosynthetic
parameters (i.e., Pn,
gs, PSII, and NPQ) under SK conditions (Figs. 5A–5D).
In contrast, the lines were much more improved on photosynthetic function under
DK treatment, showing higher Pn, gs,
and PSII and lower NPQ values than wild type plants (Figs. 5A–5D).
Discussion
The external K levels act as one of the critical factors
for crop production, regulating largely plant growth, development, and the
yield formation capacity (Shen et al. 2014; Wani et al.
2014). Suitable application of potassium fertilizers can balance the
environmental K nutrition and positively impact on the plant dry matter
accumulation and the productivity, given the improved cellular osmotic
regulation potential (Zamir et al.
2013), abiotic stress adaptation, and the associated physiological processes (Wu et al. 2005). In addition, rational
management on K fertilizers enhances the water use efficiencies of plants once
challenged by deficit water supplies (Wang et
al. 2017). In this study, the K uptake and the agronomic traits in wheat
cultivars were investigated under different K input treatments combined by
deficit irrigation. The K concentrations, plant biomass, and the K accumulative
amounts of plants in tested cultivars were lowered at various growth stages
under DK than under SK, which further affects the agronomic trait behavior of
wheat cultivars. These results indicated the promotion effects of suitably
supplied K nutrition on plant K uptake, which benefits the productivity of
winter wheat cultivars treated by deficit irrigation.
Fig. 5: Photosynthetic parameters of the lines overexpressing TaHAK3 and TaHAK5 under different K input treatments
A, Pn; B, gs; C, ¦·PSII; D, NPQ. SK, sufficient-K. DK, deficient-K. HAK3-1 and HAK3-3, two
lines with overexpressionof TaHAK3; HAK5-2 and HAK5-3, two lines with overexpression of TaHAK5. Data shown are averages
derived from triplicate results together with standard errors. Symbol *
indicates to be significantly different between transgenic lines and wild type according
to Student T-test at 0.05 level
Improvement of photosynthetic function under abiotic
stresses, such as drought, positively regulates plant biomass production and
the yield potential (Liao and Wang 2002; Inoue et al. 2004). Previous investigations indicated the enhanced
photosynthetic trait behavior in drought tolerant wheat cultivars under water
deprivation condition compared with drought sensitive ones (Liu and Li 2005; Wu
et al. 2014). In this study,
photosynthetic traits, such as Chl, Pn,
¦·PSII, and NPQ, obtained similar results to previous
studies. Under DI condition, Kenong 9204, the drought tolerant cultivar,
displayed higher Chl,
Pn, and¦·PSII whereas lower NPQ in upper leaves of plants than Jimai 120, a drought sensitive one. These results suggest
that the drought tolerant cultivars can sustain relatively improved photosynthetic
process under water deprivation, which contributes to their enhanced yield potential
in drought-challenged conditions.
The K uptake and internal K ion translocation across
plant tissues are mediated by the potassium transporter (HAK)-associated
proteins (Coskun et al. 2013). During
these molecular processes, ATP initiated from respiratory cycle was used as the
driving power (Ragel et al. 2019). Several investigations have validated the functions
of distinct HAK family members in mediating plant K taken up or the internal K
remobilization processes. For example, a set of the HAK genes in plant species
are K deprivation responsive at transcription level, displaying significantly
upregulated transcripts in the K-deprived plants (Brauer
et al. 2016; Cheng et al. 2018). The transgenic plants with
overexpression of distinct HAK family genes are significantly improved on the K
accumulation and the growth traits under low-K treatment (Yang et al. 2014; Ahmad et al. 2016). These findings suggest the potential roles of
distinct HAK genes in regulating plant K deprivation responses. In this study,
to address the molecular processes underlying improved K uptake under DK in the
wheat plants, a suite of HAK family genes in T. aestivum (i.e., TaHAK1 to TaHAK13) were subjected to transcript
evaluation under contrasting K input conditions. Results revealed that TaHAK3 and TaHAK5 are differentially expressed upon modified external K levels,
showing to be upregulated in the K-deprived plants of the two wheat cultivars
examined, with more transcripts abundance in the Kenong 9204 plants than that Jimai 120 ones. These results contrast with other genes
unaltered on transcription in the cultivars plants between both SK and DK
conditions. Based on transgene analysis, the biological roles of TaHAK3 and TaHAK5 in mediating plant low-K tolerance were validated; the lines
with overexpression of these two HAK family genes were much improved on K concentrations,
biomass, and K accumulative amounts of plants together with enhanced
photosynthetic function under DK conditions. Therefore, distinct HAK members such as TaHAK3 and TaHAK5 act as critical regulators and exert essential roles
in regulating the plant uptake of K nutrition under DK conditions (Fig. 4 and
5), which further positively impact on the physiological processes associated with
photosynthesis, biomass production, and yield formation capacity of the winter
wheat cultivars. They are thus to be acted as valuable indices in evaluating
behaviors of KUE and the yield potential in winter wheat cultivated under the
K-saving and deficit irrigation conditions.
Conclusion
Dramatically, genetic
variation on growth and K-associated traits was found in the winter wheat
cultivars under K deprivation. The high KUE cultivar exhibits improved capacities to take up
K, photosynthesis, plant biomass production, and agronomic traits under DK
conditions. Distinct family members in the potassium transporter (HAK) family (TaHAK3 and TaHAK5)
display modified transcription efficiency upon K deprivation, with more
transcripts in the high KUE cultivars than in the cultivars to be low-K stress
sensitive. Overexpression of the differential HAK family genes leads to improved
K-associated traits, photosynthetic function, plant biomass production,
suggesting their essential roles in positively regulating plant K uptake under
low-K treatment in winter wheat cultivars.
Acknowledgements
This work was financially supported by Chinese National
Key Research and Development Project on Science and Technology
(2017YFD0300902).
Author Contributions
XB, ZC, FL and SZ
planned the experiments, KX interpreted the results and made the write up, YZ
statistically analyzed the data and made illustrations.
Conflicts of Interest
All other authors
declare no conflicts of interest
Data Availability
Data presented in this
study are available on fair request to the corresponding author.
Ethics Approval
Not applicable.
References
Ahmad I, A Mian, FJM Maathuis (2016). Overexpression
of the rice AKT1 potassium channel affects potassium nutrition and rice drought
tolerance. J Exp Bot 67:2689–2698
Brauer EK, N Ahsan, R Dale, N
Kato, AE Coluccio, MA Piñeros,
LV Kochian, JJ Thelen, SC
Popescu (2016). The Raf-like kinase ILK1 and the high affinity K+ transporter
HAK5 are required for innate immunity and abiotic stress response. Plant Physiol 171:1470–1484
Cheng X, X Liu, W Mao, X
Zhang, S Chen, K Zhan, H Bi, H Xu (2018). Genome-wide identification and analysis
of HAK/KUP/KT potassium transporters gene family in wheat (Triticum aestivum L.). Intl J Mol Sci 19:3969–3989
Coskun D, DT Britto, M
Li, S Oh, HJ Kronzucker (2013). Capacity and plasticity
of potassium channels and high-affinity transporters in roots of barley and Arabidopsis. Plant Physiol 162:496–511
Erdei L, Z Ol¨˘h, A B¨¦rezi (2006). Phases in potassium transport and their
regulation under near-equilibrium conditions in wheat seedlings. Physiol Plantarum 60:81–85
Guo C, X Zhao, X Liu, L
Zhang, J Gu, X Li, W Lu, K Xiao (2013). Function of wheat phosphate transporter
gene TaPHT2;1 in Pi translocation and
plant growth regulation under replete and limited Pi supply conditions. Planta 237:1163–1178
Guo C, W Chang, L
Zhang, X Cui, S Li, K Xiao (2011). Effects of chromosome substitution on the
utilization efficiency of nitrogen, phosphorus, and potassium in wheat. Front Agric Chin 5; Article 253
Hu Y, Y Liu, H Tang, Y Xu, J Pan (2014).
Contribution of drought to potential crop yield reduction in a wheat-maize
rotation region in the north china plain. J Integr
Agric 13:1509–1519
Inoue T, S Inanaga,
Y Sugimoto (2004). Contribution of pre-anthesis assimilates and current photosynthesis
to grain yield, and their relationships to drought resistance in wheat cultivars
grown under different soil moisture. Photosynthetica 42:99–104
Liao J, G Wang (2002). Effects of drought,
CO2 concentration and temperature increasing on photosynthesis rate,
evapotranspiration, and water use efficiency of spring wheat. Chin J Appl Ecol 13:547–550
Liu HS, FM Li (2005). Root respiration,
photosynthesis and grain yield of two spring wheat in response to soil drying. Plant Growth Regul
46:233–240
Lupton FGH (2008). Further experiments
on photosynthesis and translocation in wheat. Ann Appl Biol 71:69–79
Ma S, Z Yu, Y Shi, Z Gao, L Luo, P Chu
(2015). Soil water use, grain yield and water use efficiency of winter wheat in
a long-term study of tillage practices and supplemental irrigation on the north
china plain. Agric Water Manage 150:9–17
Ragel P, N Raddatz, EO Leidi, FJ Quintero, JM Pardo (2019). Regulation of K+
nutrition in plants. Front Plant Sci 10;
Article 281
Rengel Z, PM Damon (2008). Crops and genotypes differ in
efficiency of potassium uptake and use. Physiol Plantarum 133:624–636
Shen X, G Huang, H Qu, H Wang, H Chen,
S Chen (2014). Effects of potassium application amount on dry matter production
and nitrate accumulation of nanzishu 008. J South Agric
45:235–239
Song W, R Xue,
Y Song, Y Bi, Y Zhang (2017). Differential response of first-order lateral root
elongation to low potassium involves nitric oxide in two tobacco cultivars. J
Plant Growth Regul 37:114–127
Wang B, Y Zhang, B Hao, X Xu, Z Zhao, Z
Wang (2016). Grain yield and water use efficiency in extremely-late sown winter
wheat cultivars under two irrigation regimes in the North China plain. PLoS One 11; Article e0153695
Wang L, S Wang, W Chen, H Li, X Deng (2017).
Physiological mechanisms contributing to increased water-use efficiency in
winter wheat under organic fertilization. PLoS
One 12; Article e0180205
Wani JA, MA Malik, MA Dar, F Akhter, SK Raina (2014).
Impact of method of application and concentration of potassium on yield of
wheat. J Environ Biol 35:623–626
Woodend JJ, ADM Glass, CO Person (1987).
Genetic variation in the uptake and utilization of potassium in wheat (Triticum aestivum
L.) varieties grown under potassium stress. Plant
Soil 10:254–254
Wu J, X Guo, X Li, W Wang, H Zhu (2005).
Effect of phosphorus fertilizer and potassium fertilizer continuous application
on nutrient uptake and yield of maize, rapeseed. Chin Agric Sci Bull 71:1170–1183
Wu YL, QF Guo, Y Luo (2014).
Differences in physiological characteristics between two wheat cultivars
exposed to field water deficit conditions. Russ
J Plant Physiol 61:451–459
Yang T, S Zhang, Y Hu, F
Wu, Q Hu, G Chen, J Cai, T Wu, N Moran, L Yu, G Xu (2014). The role of a potassium
transporter OsHAK5 in potassium acquisition and transport from roots to shoots
in rice at low potassium supply levels. Plant
Physiol 166:945–959
Zamir MSI, I Afzal, M Yaseen, M Mubeen,
M Aslam (2013). Drought stress, its effect on maize production and development
of drought tolerance through potassium application. Cercet
Agron Mold 46:99–144
Zhang G, J Chen, AT Eshetu (1999). Genotypic
variation for potassium uptake and utilization efficiency in wheat. Nutr Cycl Agroecosyst 54:41–48